Genetic heterogeneity in Loa loa parasites from southern Cameroon: A preliminary study
-
* Corresponding author: Thomas R Unnasch trunnasch@geomed.dom.uab.edu
1 Division of Geographic Medicine, University of Alabama at Birmingham, Birmingham, AL USA
2 Laboratory of Parasitic Diseases, National Institutes of Health, Bethesda, MD USA
3 Institut de Recherche pour le Developpement, Departement Societes et Sante, Paris, France
Filaria Journal 2004, 3:4 doi:10.1186/1475-2883-3-4
The electronic version of this article is the complete one and can be found online at: http://www.filariajournal.com/content/3/1/4
| Received: | 22 April 2004 |
| Accepted: | 29 June 2004 |
| Published: | 29 June 2004 |
© 2004 Higazi et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.
Abstract
Ivermectin (or Mectizan™) is widely used by onchocerciasis and lymphatic filariasis control programs worldwide. Generally, Mectizan™ is both safe and well tolerated. An exception to this general pattern is in some areas co-endemic for Onchocerca volvulus and Loa loa, where a number of severe adverse reactions to Mectizan™ have been noted in L. loa infected individuals. The vast majority of these severe adverse events have occurred in Southern Cameroon. This suggested the hypothesis that the parasites endemic to Southern Cameroon might form a distinct population that exhibited a phenotype of eliciting severe adverse reactions in Loa-infected individuals upon Mectizan™ exposure. To test this hypothesis, the DNA sequences of three potentially polymorphic loci were compared among L. loa parasites from Southern Cameroon and other endemic foci in Sub-Saharan Africa. Analysis of these data suggested that parasites from Southern Cameroon were at least as genetically diverse as those from other foci. Furthermore, no polymorphisms were noted that were unique to and shared among the parasite isolates from Southern Cameroon. Although a limited number of parasite isolates were tested, these results do not appear to support the hypothesis that L. loa parasites from Southern Cameroon represent a unique, genetically isolated population.
Findings
Ivermectin (Mectizan™) is a semi-synthetic lactone drug that exhibits broad anti-helminthic specificity [1]. Mectizan™ has become the drug of choice for mass chemotherapy campaigns to eliminate onchocerciasis as a public health problem [2]. In general, these mass chemotherapy projects have been associated with few complications. A notable exception occurs in some areas where the agent of onchocerciasis, Onchocerca volvulus, is sympatric with Loa loa, the causative agent of another filarial infection of humans. Over the past several years, severe adverse reactions to Mectizan™ treatment have been reported in individuals residing in onchocerciasis endemic areas that are also endemic for L. loa [3-5]. These adverse reactions are characterized by severe neurological complications, including incontinence, coma, and in some cases, death of the patient [3,5]. Interestingly, a large majority of the individuals suffering from such severe adverse reactions have resided in Southern Cameroon [6-8]. The development of severe reactions to Mectizan™ in L. loa infected individuals has had a negative impact on the design and implementation of Mectizan™ distribution campaigns to control onchocerciasis in areas where O. volvulus and L. loa are co-endemic [9].
Parasitological examinations of patients who developed post-Mectizan™ encephalopathy showed a correlation between the risk of developing such reactions and the L. loa microfilarial load [10]. However, the finding that the vast majority of such severe reactions occurred in a localized geographic area also suggested that the parasites endemic to this area might represent a genetically distinct population that is particularly capable of inducing adverse reactions in the host upon being exposed to Mectizan™. If the parasites from Southern Cameroon represent a genetically distinct population, it would follow that genetic exchange with other parasite populations would be expected to be limited or non-existent. Such reproductively isolated populations often suffer from a genetic founder effect, resulting in a population in which the level of genetic heterogeneity is severely limited, and in which the distribution of alleles in the isolated population is often strikingly different from that seen in non-reproductively isolated populations. Furthermore, prolonged reproductive isolation of a population will result in the accumulation of population specific genetic polymorphisms. If this occurs, phylogenic analyses based upon data collected from isolates from within and outside of the isolated population should result in a phylogeny in which the isolates from within the isolated population are grouped together.
Very little is known concerning the degree of genetic diversity among different populations of L. loa and the role that such genetic polymorphisms may play in the adverse responses to Mectizan™ treatment. Simian and human strains of L. loa, which differ in the length of the microfilariae and their periodicity in the host have long been recognized [11,12]. Despite these differences, human and simian L. loa are believed to be the same species, as experimental studies have shown that parasites from these two primate hosts can hybridize [12]. Because parasites from the two hosts differ in periodicity and are transmitted by different species of the Chrysops genus, it has been proposed that the human and simian parasites "are at an early stage of radiative evolution" [11]. Whether hybridization of the simian and human strains is a co-factor in the development of post-Mectizan™ encephalopathy is unknown [13]. Some biochemical variation has also been reported among different populations of human L. loa [14], although these differences have not been explored at the genetic level.
Perhaps the most well documented case of the importance of genetic factors in the pathogenesis of a human filarial infection is in onchocerciasis. Human onchocerciasis exhibits two distinct clinical and epidemiologic disease patterns in the rain forest and savanna bioclimes of West Africa [15,16]. Studies have revealed a strong correlation between the classification based upon the epidemiological disease pattern and the pattern of hybridization to strain specific DNA sequences derived from a repeated sequence encoded in the nuclear genome of O. volvulus [17]. Subsequent studies have demonstrated that variation within this repeat population could be used as a tool for biogeographic studies [18,19]. In Ascaris suum [20], Ostertagia osteragi [21] and Haemonchus contortus [22] mitochondrially encoded sequences have proven to contain useful polymorphisms for population based studies. Similarly, the internal transcribed spacer (ITS) of the ribosomal RNA gene cluster has been used to develop markers capable of distinguishing different populations of Haemonchus contortus [23].
To test the hypothesis that L. loa endemic to Southern Cameroon represents a distinct population, four parasite isolates were obtained from Southern Cameroon. These parasites consisted of infective larvae obtained from four individual wild caught L. loa infected Chrysops dimidiata vector flies collected in the village of Ngat (3°25'N, 11°33'E), located approximately 50 km south of the capital of Yaoundé. Previous studies have reported cases of L. loa encephalopathy in this village [24]. Individual isolates were also obtained from blood collected from L. loa infected expatriate former residents of Nigeria, Gabon and The Democratic Republic of the Congo at the Laboratory of Parasitic Diseases at the National Institutes of Health in Bethesda, MD, USA. DNA was extracted from the parasite preparations, following previously described methods [25]. These DNA samples were then used as templates in PCR amplification reactions targeting three gene sequences: the mitochondrial 16S rRNA gene, the ITS2 domain of the nuclear rRNA gene cluster, and the 15r3 polyprotein gene in L. loa. The 15r3 gene has previously been shown to be polymorphic and useful in the development of a DNA based diagnostic assay for this parasite [26,27]. These gene sequences were chosen for study because, as discussed above, homologues (or related sequences) have previously been shown to be informative population based markers in studies of other parasitic nematodes. PCR amplicons resulting from these reactions were subjected to direct DNA sequence analysis to identify sequence polymorphisms.
All of the DNA templates were successfully amplified with the primer set derived from the mitochondrial 16S rRNA gene. However, no polymorphisms were noted in the amplification products analyzed (data not shown). Amplification products were also obtained from all of the samples targeting the 15r3 polyprotein gene. Several polymorphic sites were found in the 15R3 amplicons. Interestingly, sequences derived from DNA extracted from the blood of L. loa infected individuals from Gabon, Nigeria and The Democratic Republic of the Congo were identical (Figure 1, Panel A). One of the isolates from Southern Cameroon also contained a 15R3 sequence which was identical to that found in the parasite isolates from the other countries. However, the remaining three isolates from Southern Cameroon contained between 3 and 7 polymorphic sites when compared to the canonical sequence found in the other parasites (Figure 1, Panel A). These data suggest that the 15R3 gene sequences from parasites obtained from Southern Cameroon were at least as polymorphic as those from other L. loa foci in Sub-Saharan Africa. None of the polymorphisms were consistently found among the isolates from Southern Cameroon, suggesting that these polymorphisms probably did not arise from evolution in a genetically homogeneous, reproductively isolated population (data not shown).
Figure 1. Analysis of polymorphisms in the 15r3 and ITS2 gene sequences of L. loa: Panel A: Pairwise differences in 15r3 amplicon sequences among L. loa isolates. The 15R3 gene fragment was amplified from L. loa genomic DNA (2.5 μl per reaction) using primers with the sequences 5' GGCACAAAACACTGCAGCAGTCCT
3' and 5' CAGCTGTCTCAAATCGAAGATTCT 3'. A total of 2.5 units of Taq polymerase (Roche
Applied Biochemicals, Indianapolis, USA) was used in each 50 μl amplification reaction,
together with the reaction buffer supplied by the manufacturer. Amplification conditions
consisted of an initial denaturation of 5 minutes at 94°C, followed by 40 cycles consisting
of 1 minute at 94°C, 1 minute at 49°C, and 2 minutes at 72°C. Reactions were completed
by a final extension at 72°C for 7 minutes. The amplicon analyzed was 318 nucleotides
long. Distances were calculated using the two parameter method [28]. Panel B: Pairwise
differences in ITS2 amplicon sequences among L. loa isolates. The ITS2 gene fragment was amplified from L. loa genomic DNA (2.5 μl per reaction) using primers with the sequences 5' TAACAATGAAGATAAAGCGA
3' and 5' TTAGTTTCTTTTCCTCCGCT 3'. A total of 2.5 units of Taq polymerase (Roche Applied
Biochemicals, Indianapolis, USA) was used in each 50 μl amplification reaction, together
with the reaction buffer supplied by the manufacturer. Amplification conditions consisted
of an initial denaturation of 5 minutes at 94°C, followed by 40 cycles consisting
of 1 minute at 94°C, 1 minute at 50°C, and 2 minutes at 72°C. Reactions were completed
by a final extension at 72°C for 7 minutes. The amplicon analyzed was 472 nucleotides
long. Distances were calculated using the two parameter method [28]. Panel C: Phylogenetic
tree developed from the ITS2 sequence data. The phylogeny was developed using parsimony
methods, performing an exhaustive search of the data with the parsimony routines in
the PAUP program package (v4.0, release 10) [29]. The robustness of the phylogeny
was tested by running 1000 synthetic datasets with the bootstrap method in the PAUP
program package. As indicated on the figure, the division of the four sequences into
the two clades shown was supported 70% of the time in the bootstrap analysis.
Amplification of the ITS2 locus was successful from L. loa DNA samples from Nigeria, Gabon and two of four samples from Southern Cameroon. Again, several polymorphisms were noted among the four samples examined (Figure 1, Panel B). However, none of these polymorphisms were specific to and conserved in the two isolates from Southern Cameroon. Thus, an analysis of the sequence data using parsimony methods did not support a phylogeny that grouped the two isolates from Southern Cameroon (Figure 1, Panel C).
The data presented above are preliminary, and involve the analysis of a limited number of sequences from a small number of parasite isolates. Nevertheless, some conclusions are suggested by these results. First, it appears that genetic variation in parasites from the focus in Southern Cameroon is at least as frequent as in parasites from other locations. Second, no polymorphisms were noted which were unique to the parasites from Southern Cameroon and also shared among the isolates examined from this focus. Together, these observations argue against the hypothesis that the parasites found in Southern Cameroon represent a distinct, reproductively isolated population. Analysis of additional parasite samples and additional loci will be necessary to confirm this.
This study revealed a considerable amount of sequence variation in the two nuclearly encoded genes examined. If this level of sequence heterogeneity is representative of the rest of the nuclear genome, this suggests that the L. loa population from Southern Cameroon is fairly genetically heterogeneous. It is therefore possible that a proportion of the parasites from Southern Cameroon contain allelic variants of genes that result in enhanced virulence and/or pathogenicity in the face of Mectizan™ treatment. This might explain the fact that severe adverse reactions in response to Mectizan™ treatment are confined to a small proportion of the treated population. To test this hypothesis, it will be necessary to obtain parasites from individuals who exhibit the preliminary symptoms of a severe adverse reaction shortly following Mectizan™ distribution, when L. loa microfilariae are still likely to be present in the circulation.
Competing Interests
None declared.
Author's Contributions
TBH was responsible for carrying out the laboratory experiments described in the manuscript, including DNA isolation, PCR amplification and DNA sequence analysis. AK and MB were involved in the experimental planning and conducted the field work involved in obtaining the samples. TRU served as the Principal Investigator on the project. He was responsible for obtaining grant support for the project, for assisting in the experimental design, data analysis and for preparation of the manuscript.
Acknowledgements
We would like to thank Dr. M. Demanou, who assisted with collection of Chrysops from which Loa loa infective larvae were isolated, and Dr. Naomi Lang-Unnasch for critical reading of this manuscript. This investigation received financial support from the UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR), Project #991105.
References
-
Goa KL, McTavish D, Clissold SP: Ivermectin. A review of its antifilarial activity, pharmacokinetic properties and clinical efficacy in onchocerciasis.
Drugs 1991, 42:640-658. PubMed Abstract
-
Molyneux DH, Davies JB: Onchocerciasis control: Moving towards the millennium.
Parasitology Today 1997, 13:418-424. Publisher Full Text
-
Gardon J, Gardon-Wendel N, Demanga N, Kamgno J, Chippaux JP, Boussinesq M: Serious reactions after mass treatment of onchocerciasis with ivermectin in an area endemic for Loa loa infection.
Lancet 1997, 350:18-22. PubMed Abstract | Publisher Full Text
-
Twum-Danso NA: Serious adverse events following treatment with ivermectin for onchocerciasis control: a review of reported cases.
Filaria Journal 2003, 2:S3.. PubMed Abstract | Publisher Full Text
-
Boussinesq M, Gardon J, Gardon-Wendel N, Chippaux JP: Clinical picture, epidemiology and outcome of Loa-associated serious adverse events related to mass ivermectin treatment of onchocerciasis in Cameroon.
Filaria Journal 2003, 2:S4.. PubMed Abstract | BioMed Central Full Text
-
Boussinesq M, Gardon J, Gardon-Wendel N, Kamgno J, Ngoumou P, Chippaux JP: Three probable cases of Loa loa encephalopathy following ivermectin treatment for onchocerciasis.
American Journal of Tropical Medicine and Hygiene 1998, 58:461-469. PubMed Abstract | Publisher Full Text
-
Twum-Danso NA: Loa loa encephalopathy temporally related to ivermectin administration reported from onchocerciasis mass treatment programs from 1989 to 2001: Implications for the future.
Filaria Journal 2003, 2:S7.. PubMed Abstract | Publisher Full Text
-
Twum-Danso NA, Meredith SE: Variation in incidence of serious adverse events after onchocerciasis treatment with ivermectin in areas of Cameroon co-endemic for loiasis.
Tropical Medicine and International Health 2003, 8:820-831. PubMed Abstract | Publisher Full Text
-
Haselow NJ, Akame J, Evini C, Akongo S: Programmatic and Communication Issues in Relation to Serious Adverse Events Following Ivermectin Treatment in areas Co-endemic for Onchocerciasis and Loiasis.
Filaria Journal 2003, 2:S10.. PubMed Abstract | BioMed Central Full Text
-
Duke BOL, Wijers DJB: Studies on loiasis in monkeys. I. The relationship between human and simian Loa in the rain-forest zone of the British Cameroons.
Annals of Tropical Medicine and Parasitology 1958, 52:158-175. PubMed Abstract
-
Duke BOL: Studies on loiasis in monkeys. IV. Experimental hybridization of the human and simian strains of Loa.
Annals of Tropical Medicine and Parasitology 1964, 58:390-408. PubMed Abstract
-
Duke BOL: Overview: Report of a Scientific Working Group on Serious Adverse Events following Mectizan(R) treatment of onchocerciasis in Loa loa endemic areas.
Filaria Journal 2003, 2:S1.. PubMed Abstract | BioMed Central Full Text
-
Ufomadu GO, Ekejindu OC, I. Tada, Shiwaku K, B.E.B. Nwoke: Acid phosphatase variations in the microfilariae of Dipetalonema perstans and Loa loa from the Jos Plateau, Nigeria.
-
Remme J, Dadzie KY, Rolland A, Thylefors B: Ocular Onchocerciasis and Intensity of Infection in the Community I. West African Savannah.
Tropical Medicine and Parasitology 1989, 40:340-347. PubMed Abstract
-
Dadzie KY, Remme J, Rolland A, Thylefors B: Ocular Onchocerciasis and Intensity of Infection in the Community II. West African Rainforest Foci of the Vector Simulium yahense.
Tropical Medicine and Parasitology 1989, 40:348-354. PubMed Abstract
-
Zimmerman PA, Dadzie KY, DeSole G, Remme J, Alley E. Soumbey, Unnasch TR: Onchocerca volvulus DNA probe classification correlates with epidemiological patterns of blindness.
Journal of Infectious Diseases 1992, 165:964-968. PubMed Abstract
-
Zimmerman PA, Katholi CR, Wooten MC, Lang-Unnasch N, Unnasch TR: Recent evolutionary history of American Onchocerca volvulus, based on analysis of a tandemly repeated DNA sequence family.
Molecular Biology and Evolution 1994, 11:384-392. PubMed Abstract | Publisher Full Text
-
Higazi TB, Katholi CR, Mahmoud BM, Baraka OZ, Mukhtar MM, Al Qubati Y, Unnasch TR: Onchocerca volvulus: Genetic Diversity of Parasite Isolates from Sudan.
Experimental Parasitology 2001, 97:24-34. PubMed Abstract | Publisher Full Text
-
Anderson TJC, Komuniecki R, Komuniecki PR, Jaenike J: Are mitochondria inherited paternally in Ascaris?
International Journal for Parasitology 1995, 25:1001-1004. PubMed Abstract | Publisher Full Text
-
Blouin MS, Dame JD, Tarrant CA, Courtney CH: Unusual population genetics of a parasitic nematode: mtDNA variation within and among populations.
-
Blouin MS, Yowell CA, Courtney CH, Dame JB: Substitution bias, rapid saturation, and the use of mtDNA for nematode systematics.
-
Gasser RB, Zhu X, Chilton NB, Newton LA, Nedergaard T, Guldberg P: Analysis of sequence homogenisation in rDNA arrays of Haemonchus contortus by denaturing gradient gel electrophoresis.
Electrophoresis 1998, 19:2391-2395. PubMed Abstract
-
Chippaux JP, Boussinesq M: [Severe secondary reactions related to ivermectin treatment in patients with loiasis (letter)].
Medecine Tropicale 1996, 56:312. PubMed Abstract
-
Klion AD, Raghavan N, Brindley PJ, Nutman TB: Cloning and characterization of a species-specific repetitive DNA sequence from Loa loa.
Molecular and Biochemical Parasitology 1991, 45:297-305. PubMed Abstract | Publisher Full Text
-
Ajuh PM, Akue JP, Boutin P, Everaere S, Egwang TG: Loa loa: Structural diversity of a 15-kDa repetitive antigen.
Experimental Parasitology 1995, 81:145-153. PubMed Abstract | Publisher Full Text
-
Toure FS, Bain O, Nerrienet E, Millet P, Wahl G, Toure Y, Doumbo O, Nicolas L, Georges AJ, McReynolds LA, Egwang TG: Detection of Loa loa-specific DNA in blood from occult-infected individuals.
Experimental Parasitology 1997, 86:163-170. PubMed Abstract | Publisher Full Text
-
Kimura M: A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences.
Journal of Molecular Evolution 1980, 16:111-120. PubMed Abstract
-
Swofford DL: PAUP: Phylogenetic analysis using parsimony (v 4.0). Sunderland, MA, Sinauer Associates; 1998.